
News & Updates


ALDH Overview


ALDH Gene Superfamily


ALDH Publications




Contact Us


Vasiliou Laboratory


Accession Details

ALDH.ORG Detail Report for Rattus norvegicus ALDH3B1 : ENSRNOT00000047041

ALDH : ALDH3B1_v2 (Alternative Splice Variant 2)
Genus, Species : Rattus norvegicus
Transcript Accession ID : ENSRNOT00000047041 (Source Database : EBI, WTSI - Ensembl - TransView)
Peptide Accession ID : ENSRNOP00000043296 (Source Database : EBI, WTSI - Ensembl - ProtView)
Genomic Accession ID : NC_005100 (Source Database : NCBI - GenBank)
Comments :  

Sequence Length (a.a.'s) : 103
Molecular Weight (Da) : 11305
Isoelectric Point : 10.09
#Amino AcidPeptide MassTotal
4 xAlanine, A71.08 = 284.32
5 xCysteine, C103.14 = 515.7
3 xAspartate, D115.09 = 345.27
2 xGlutamate, E129.12 = 258.24
6 xPhenylalanine, F147.18 = 883.08
12 xGlycine, G57.05 = 684.6
2 xHistidine, H137.14 = 274.28
2 xIsoleucine, I113.16 = 226.32
4 xLysine, K128.17 = 512.68
12 xLeucine, L113.16 = 1357.92
6 xMethionine, M131.19 = 787.14
4 xAsparagine, N114.10 = 456.4
4 xProline, P97.12 = 388.48
2 xGlutamine, Q128.13 = 256.26
9 xArginine, R156.19 = 1405.71
11 xSerine, S87.08 = 957.88
7 xThreonine, T101.11 = 707.77
5 xValine, V99.13 = 495.65
3 xTyrosine, Y163.18 = 489.54

Warning: sort() expects parameter 1 to be array, null given in C:\wamp\www\website\aldh\detail_report.php on line 850
Transcript Sequence and Structural Features (ENSRNOT00000047041) :
    1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312
Start ... Stop Length
Transcript (ENSRNOT00000047041) : 1 ... 312 = 312 bps A T G A G G G G G A G C G C T A C A T T G G T C A T C A A A C A G G T G T T G G C C C G G A C C A G C A G T G G G G G C T T C T G C G G G A A C G A T G G C T T C A T G C A C A T G A C C C T G T C C A G C C T T C C T T T T G G A G G A G T G G G A A C C A G C G G G A T G G G C A G G T A C C A C G G C A A G T T C T C C T T T G A C A C C T T T T C C A A C C A G C G T G C C T G T T T G C T G C G C A G C C C T G G G A T G G A G A A A A T C A A C G A C C T G C G C T A C C C G C C C T A C A C C A G T C G C A A C C T C A G G G T G T T G C T G G T G G C C A T G G A A A A G A G A T G C T G C A G C T G C A C G C T G C T G T A A
5' Untranslated Region (5' UTR) : N/A   - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Coding Sequence (CDS) : 1 ... 309 = 309 bps A T G A G G G G G A G C G C T A C A T T G G T C A T C A A A C A G G T G T T G G C C C G G A C C A G C A G T G G G G G C T T C T G C G G G A A C G A T G G C T T C A T G C A C A T G A C C C T G T C C A G C C T T C C T T T T G G A G G A G T G G G A A C C A G C G G G A T G G G C A G G T A C C A C G G C A A G T T C T C C T T T G A C A C C T T T T C C A A C C A G C G T G C C T G T T T G C T G C G C A G C C C T G G G A T G G A G A A A A T C A A C G A C C T G C G C T A C C C G C C C T A C A C C A G T C G C A A C C T C A G G G T G T T G C T G G T G G C C A T G G A A A A G A G A T G C T G C A G C T G C A C G C T G C T G - - -
Amino Acid Translation (ENSRNOP00000043296) : 1 ... 309 = 103 a. a.'sM
3' Untranslated Region (3' UTR) : 310 ... 312 = 3 bps - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - T A A
Poly Adenylation Tail (polyA Tail) : 313+ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Exon 1 : 1 ... 21 = 21 bps A T G A G G G G G A G C G C T A C A T T G - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Exon 2 : 22 ... 121 = 100 bps - - - - - - - - - - - - - - - - - - - - - G T C A T C A A A C A G G T G T T G G C C C G G A C C A G C A G T G G G G G C T T C T G C G G G A A C G A T G G C T T C A T G C A C A T G A C C C T G T C C A G C C T T C C T T T T G G A G G A G T G G - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Exon 3 : 122 ... 312 = 191 bps - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - G A A C C A G C G G G A T G G G C A G G T A C C A C G G C A A G T T C T C C T T T G A C A C C T T T T C C A A C C A G C G T G C C T G T T T G C T G C G C A G C C C T G G G A T G G A G A A A A T C A A C G A C C T G C G C T A C C C G C C C T A C A C C A G T C G C A A C C T C A G G G T G T T G C T G G T G G C C A T G G A A A A G A G A T G C T G C A G C T G C A C G C T G C T G T A A
Transcript and Genomicly-derived Transcript Amino Acid Translation

Deprecated: Function ereg() is deprecated in C:\wamp\www\website\includes\aldh_functions.inc on line 4842

Deprecated: Function ereg() is deprecated in C:\wamp\www\website\includes\aldh_functions.inc on line 4842

Deprecated: Function ereg() is deprecated in C:\wamp\www\website\includes\aldh_functions.inc on line 4842
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312
Transcript ENSRNOT00000047041 : A
Translation of Transcript ENSRNOT00000047041 : M
- - -
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312
Transcript Derived from the Genomic Assembly (NC_005100) : A
Translation of Transcript Derived from Genomic Assembly (NC_005100) : M
  Exon and Intron Positions on the Gene (NC_005100) :
Source Database : NCBI - GenBank
Source Database Build : NCBI Build 36.3 - March 2008
Source Database Strand : Reverse Complemented Strand (-)
Source Database Coordinates : 206400000 ... 206500000
  Please Note : The gene coordinates we provide above (Source Database Coordinates)
are the actual genomic coordinates for the gene sequence supplied by NCBI. This is the genomic
sequence we retain in our database and use to determine the exon and intron coordinates
on the genomic DNA.

Tip: How the NCBI positional coordinates system works :

Positive Strand Positions :1-2-3-4-5-6-7-8-9-10
Negative Strand Positions :1-2-3-4-5-6-7-8-9-10
Positive Strand Exon Example :Positions 5 ... 9 (position 5 to position 9)
Negative Strand Exon Example :Positions 9 ... 5 (position 9 to position 5)
  Chromosome 1, Reverse Complemented Strand (- strand)
  Exon/Intron Start ... Stop Sequence
  Exon 1: 206443450 ... 206443430 ATGAGGGGGAGCGCTACATTG
  Intron 1: 206443429 ... 206440227 GT ... 3203 bp's ... AG
  Intron 2: 206440126 ... 206438936 GT ... 1191 bp's ... AG
  Transcript Sequence for ENSRNOT00000047041 :   Peptide Translation of ENSRNOT00000047041 → ENSRNOP00000043296 :  
  >ENSRNOT00000047041 (ALDH3B1 Variant 2)
  >ENSRNOP00000043296 (ALDH3B1 Variant 2)

Copyright © 2002 - 2009, The Gene Superfamily Resource Centers