T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH1A3_v1_ENST00000329841(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GCCGAGCCGGTGCGCCGCAGACTAGGGCGCCTCGGGCCAGGGAGCGCGGAGGAGCCATGGCCACCGCTAA
CGGGGCCGTGGAAAACGGGCAGCCGGACAGGAAGCCGCCGGCCCTGCCGCGCCCCATCCGCAACCTGGAG
GTCAAGTTCACCAAGATATTTATCAACAATGAATGGCACGAATCCAAGAGTGGGAAAAAGTTTGCTACAT
GTAACCCTTCAACTCGGGAGCAAATATGTGAAGTGGAAGAAGGAGATAAGCCCGACGTGGACAAGGCTGT
GGAGGCTGCACAGGTTGCCTTCCAGAGGGGCTCGCCATGGCGCCGGCTGGATGCCCTGAGTCGTGGGCGG
CTGCTGCACCAGCTGGCTGACCTGGTGGAGAGGGACCGCGCCACCTTGGCCGCCCTGGAGACGATGGATA
CAGGGAAGCCATTTCTTCATGCTTTTTTCATCGACCTGGAGGGCTGTATTAGAACCCTCAGATACTTTGC
AGGGTGGGCAGACAAAATCCAGGGCAAGACCATCCCCACAGATGACAACGTCGTGTGCTTCACCAGGCAT
GAGCCCATTGGTGTCTGTGGGGCCATCACTCCATGGAACTTCCCCCTGCTGATGCTGGTGTGGAAGCTGG
CACCCGCCCTCTGCTGTGGGAACACCATGGTCCTGAAGCCTGCGGAGCAGACACCTCTCACCGCCCTTTA
TCTCGGCTCTCTGATCAAAGAGGCCGGGTTCCCTCCAGGAGTGGTGAACATTGTGCCAGGATTCGGGCCC
ACAGTGGGAGCAGCAATTTCTTCTCACCCTCAGATCAACAAGATCGCCTTCACCGGCTCCACAGAGGTTG
GAAAACTGGTTAAAGAAGCTGCGTCCCGGAGCAATCTGAAGCGGGTGACGCTGGAGCTGGGGGGGAAGAA
CCCCTGCATCGTGTGTGCGGACGCTGACTTGGACTTGGCAGTGGAGTGTGCCCATCAGGGAGTGTTCTTC
AACCAAGGCCAGTGTTGCACGGCAGCCTCCAGGGTGTTCGTGGAGGAGCAGGTCTACTCTGAGTTTGTCA
GGCGGAGCGTGGAGTATGCCAAGAAACGGCCCGTGGGAGACCCCTTCGATGTCAAAACAGAACAGGGGCC
TCAGATTGATCAAAAGCAGTTCGACAAAATCTTAGAGCTGATCGAGAGTGGGAAGAAGGAAGGGGCCAAG
CTGGAATGCGGGGGCTCAGCCATGGAAGACAAGGGGCTCTTCATCAAACCCACTGTCTTCTCAGAAGTCA
CAGACAACATGCGGATTGCCAAAGAGGAGATTTTCGGGCCAGTGCAACCAATACTGAAGTTCAAAAGTAT
CGAAGAAGTGATAAAAAGAGCGAATAGCACCGACTATGGACTCACAGCAGCCGTGTTCACAAAAAATCTC
GACAAAGCCCTGAAGTTGGCTTCTGCCTTAGAGTCTGGAACGGTCTGGATCAACTGCTACAACGCCCTCT
ATGCACAGGCTCCATTTGGTGGCTTTAAAATGTCAGGAAATGGCAGAGAACTAGGTGAATACGCTTTGGC
CGAATACACAGAAGTGAAAACTGTCACCATCAAACTTGGCGACAAGAACCCCTGAAGGAAAGGCGGGGCT
CCTTCCTCAAACATCGGACGGCGGAATGTGGCAGATGAAATGTGCTGGAGGAAAAAAATGACATTTCTGA
CCTTCCCGGGACACATTCTTCTGGAGGCTTTACATCTACTGGAGTTGAATGATTGCTGTTTTCCTCTCAC
TCTCCTGTTTATTCACCAGACTGGGGATGCCTATAGGTTGTCTGTGAAATCGCAGTCCTGCCTGGGGAGG
GAGCTGTTGGCCATTTCTGTGTTTCCCTTTAAACCAGATCCTGGAGACAGTGAGATACTCAGGGCGTTGT
TAACAGGGAGTGGTATTTGAAGTGTCCAGCAGTTGCTTGAAATGCTTTGCCGAATCTGACTCCAGTAAGA
ATGTGGGAAAACCCCCTGTGTGTTCTGCAAGCAGGGCTCTTGCACCAGCGGTCTCCTCAGGGTGGACCTG
CTTACAGAGCAAGCCACGCCTCTTTCCGAGGTGAAGGTGGGACCATTCCTTGGGAAAGGATTCACAGTAA
GGTTTTTTGGTTTTTGTTTTTTGTTTTCTTGTTTTTAAAAAAAGGATTTCACAGTGAGAAAGTTTTGGTT
AGTGCATACCGTGGAAGGGCGCCAGGGTCTTTGTGGATTGCATGTTGACATTGACCGTGAGATTCGGCTT
CAAACCAATACTGCCTTTGGAATATGACAGAATCAATAGCCCAGAGAGCTTAGTCAAAGACGATATCACG
GTCTACCTTAACCAAGGCACTTTCTTAAGCAGAAAATATTGTTGAGGTTACCTTTGCTGCTAAAGATCCA
ATCTTCTAACGCCACAACAGCATAGCAAATCCTAGGATAATTCACCTCCTCATTTGACAAATCAGAGCTG
TAATTCGCTTTAACAAATTACGCATTTCTATCACGTTCACTAACAGCTTATGATAAGTCTGTGTAGTCTT
CCTTTTCTCCAGTTCTGTTACCCAATTTAGATTAGTAAAGCGTACACAACTGGAAAGACTGCTGTAATAA
CACAGCCTTGTTATTTTTAAGTCCTATTTTGATATTAATTTCTGATTAGTTAGTAAATAACACCTGGATT
CTATGGAGGACCTCGGTCTTCATCCAAGTGGCCTGAGTATTTCACTGGCAGGTTGTGAATTTTTCTTTTC
CTCTTTGGGGATCCAAATGATGATGTGCAATTTCATGTTTTAACTTGGGAAACTGAAAGTGTTCCCATAT
AGCTTCAAAAACAAAAACAAATGTGTTATCCGACGGATACTTTTATGGTTACTAACTAGTACTTTCCTAA
TTGGGAAAGTAGTGCTTAAGTTTGCAAATTAAGTTGGGGAGGGCAATAATAAAATGAGGGCCCGTAACAG
AACCAGTGTGTGTATAACGAAAACCATGTATAAAATGGGCCTATCACCCTTGTCAGAGATATAAATTACC
ACATTTGCCTTCCCTTCATCAGCTAACACTTATCACTTATACTACCAATAACTTGTTAAATCAGGATTTG
GCTTCATACACTGAATTTTCAGTATTTTATCTCAAGTAGATATAGACACTAACCTTGATAGTGATACGTT
AGAGGGTTCCTATTCTTCCATTGTACGATAATGTCTTTAATATGAAATGCTACATTATTTATAATTGGTA
GAGTTATTGTATCTTTTTATAGTTGTAAGTACACAGAGGTGGTATATTTAAACTTCTGTAATATACTGTA
TTTAGAAATGGAAATATATATAGTGTTAGGTTTCACTTCTTTTAAGGTTTACCCCTGTGGTGTGGTTTAA
AAATCTATAGGCCTGGGAATTCCGATCCTAGCTGCAGATCGCATCCCACAATGCGAGAATGATAAAATAA
AATTGGATATTTG

>ALDH1A3_v1_NM_000693(Source : NCBI - GenBank, Homo sapiens)
AAAGCGGCGGGGAGCTGCCACCCCGGGAGCGGGCTGCGCAGTGTCCGGGCCGAGCCGGTGCGCCGCAGAC
TAGGGCGCCTCGGGCCAGGGAGCGCGGAGGAGCCATGGCCACCGCTAACGGGGCCGTGGAAAACGGGCAG
CCGGACAGGAAGCCGCCGGCCCTGCCGCGCCCCATCCGCAACCTGGAGGTCAAGTTCACCAAGATATTTA
TCAACAATGAATGGCACGAATCCAAGAGTGGGAAAAAGTTTGCTACATGTAACCCTTCAACTCGGGAGCA
AATATGTGAAGTGGAAGAAGGAGATAAGCCCGACGTGGACAAGGCTGTGGAGGCTGCACAGGTTGCCTTC
CAGAGGGGCTCGCCATGGCGCCGGCTGGATGCCCTGAGTCGTGGGCGGCTGCTGCACCAGCTGGCTGACC
TGGTGGAGAGGGACCGCGCCACCTTGGCCGCCCTGGAGACGATGGATACAGGGAAGCCATTTCTTCATGC
TTTTTTCATCGACCTGGAGGGCTGTATTAGAACCCTCAGATACTTTGCAGGGTGGGCAGACAAAATCCAG
GGCAAGACCATCCCCACAGATGACAACGTCGTGTGCTTCACCAGGCATGAGCCCATTGGTGTCTGTGGGG
CCATCACTCCATGGAACTTCCCCCTGCTGATGCTGGTGTGGAAGCTGGCACCCGCCCTCTGCTGTGGGAA
CACCATGGTCCTGAAGCCTGCGGAGCAGACACCTCTCACCGCCCTTTATCTCGGCTCTCTGATCAAAGAG
GCCGGGTTCCCTCCAGGAGTGGTGAACATTGTGCCAGGATTCGGGCCCACAGTGGGAGCAGCAATTTCTT
CTCACCCTCAGATCAACAAGATCGCCTTCACCGGCTCCACAGAGGTTGGAAAACTGGTTAAAGAAGCTGC
GTCCCGGAGCAATCTGAAGCGGGTGACGCTGGAGCTGGGGGGGAAGAACCCCTGCATCGTGTGTGCGGAC
GCTGACTTGGACTTGGCAGTGGAGTGTGCCCATCAGGGAGTGTTCTTCAACCAAGGCCAGTGTTGCACGG
CAGCCTCCAGGGTGTTCGTGGAGGAGCAGGTCTACTCTGAGTTTGTCAGGCGGAGCGTGGAGTATGCCAA
GAAACGGCCCGTGGGAGACCCCTTCGATGTCAAAACAGAACAGGGGCCTCAGATTGATCAAAAGCAGTTC
GACAAAATCTTAGAGCTGATCGAGAGTGGGAAGAAGGAAGGGGCCAAGCTGGAATGCGGGGGCTCAGCCA
TGGAAGACAAGGGGCTCTTCATCAAACCCACTGTCTTCTCAGAAGTCACAGACAACATGCGGATTGCCAA
AGAGGAGATTTTCGGGCCAGTGCAACCAATACTGAAGTTCAAAAGTATCGAAGAAGTGATAAAAAGAGCG
AATAGCACCGACTATGGACTCACAGCAGCCGTGTTCACAAAAAATCTCGACAAAGCCCTGAAGTTGGCTT
CTGCCTTAGAGTCTGGAACGGTCTGGATCAACTGCTACAACGCCCTCTATGCACAGGCTCCATTTGGTGG
CTTTAAAATGTCAGGAAATGGCAGAGAACTAGGTGAATACGCTTTGGCCGAATACACAGAAGTGAAAACT
GTCACCATCAAACTTGGCGACAAGAACCCCTGAAGGAAAGGCGGGGCTCCTTCCTCAAACATCGGACGGC
GGAATGTGGCAGATGAAATGTGCTGGAGGAAAAAAATGACATTTCTGACCTTCCCGGGACACATTCTTCT
GGAGGCTTTACATCTACTGGAGTTGAATGATTGCTGTTTTCCTCTCACTCTCCTGTTTATTCACCAGACT
GGGGATGCCTATAGGTTGTCTGTGAAATCGCAGTCCTGCCTGGGGAGGGAGCTGTTGGCCATTTCTGTGT
TTCCCTTTAAACCAGATCCTGGAGACAGTGAGATACTCAGGGCGTTGTTAACAGGGAGTGGTATTTGAAG
TGTCCAGCAGTTGCTTGAAATGCTTTGCCGAATCTGACTCCAGTAAGAATGTGGGAAAACCCCCTGTGTG
TTCTGCAAGCAGGGCTCTTGCACCAGCGGTCTCCTCAGGGTGGACCTGCTTACAGAGCAAGCCACGCCTC
TTTCCGAGGTGAAGGTGGGACCATTCCTTGGGAAAGGATTCACAGTAAGGTTTTTTGGTTTTTGTTTTTT
GTTTTCTTGTTTTTAAAAAAAGGATTTCACAGTGAGAAAGTTTTGGTTAGTGCATACCGTGGAAGGGCGC
CAGGGTCTTTGTGGATTGCATGTTGACATTGACCGTGAGATTCGGCTTCAAACCAATACTGCCTTTGGAA
TATGACAGAATCAATAGCCCAGAGAGCTTAGTCAAAGACGATATCACGGTCTACCTTAACCAAGGCACTT
TCTTAAGCAGAAAATATTGTTGAGGTTACCTTTGCTGCTAAAGATCCAATCTTCTAACGCCACAACAGCA
TAGCAAATCCTAGGATAATTCACCTCCTCATTTGACAAATCAGAGCTGTAATTCGCTTTAACAAATTACG
CATTTCTATCACGTTCACTAACAGCTTATGATAAGTCTGTGTAGTCTTCCTTTTCTCCAGTTCTGTTACC
CAATTTAGATTAGTAAAGCGTACACAACTGGAAAGACTGCTGTAATAACACAGCCTTGTTATTTTTAAGT
CCTATTTTGATATTAATTTCTGATTAGTTAGTAAATAACACCTGGATTCTATGGAGGACCTCGGTCTTCA
TCCAAGTGGCCTGAGTATTTCACTGGCAGGTTGTGAATTTTTCTTTTCCTCTTTGGGGATCCAAATGATG
ATGTGCAATTTCATGTTTTAACTTGGGAAACTGAAAGTGTTCCCATATAGCTTCAAAAACAAAAACAAAT
GTGTTATCCGACGGATACTTTTATGGTTACTAACTAGTACTTTCCTAATTGGGAAAGTAGTGCTTAAGTT
TGCAAATTAAGTTGGGGAGGGCAATAATAAAATGAGGGCCCGTAACAGAACCAGTGTGTGTATAACGAAA
ACCATGTATAAAATGGGCCTATCACCCTTGTCAGAGATATAAATTACCACATTTGCCTTCCCTTCATCAG
CTAACACTTATCACTTATACTACCAATAACTTGTTAAATCAGGATTTGGCTTCATACACTGAATTTTCAG
TATTTTATCTCAAGTAGATATAGACACTAACCTTGATAGTGATACGTTAGAGGGTTCCTATTCTTCCATT
GTACGATAATGTCTTTAATATGAAATGCTACATTATTTATAATTGGTAGAGTTATTGTATCTTTTTATAG
TTGTAAGTACACAGAGGTGGTATATTTAAACTTCTGTAATATACTGTATTTAGAAATGGAAATATATATA
GTGTTAGGTTTCACTTCTTTTAAGGTTTACCCCTGTGGTGTGGTTTAAAAATCTATAGGCCTGGGAATTC
CGATCCTAGCTGCAGATCGCATCCCACAATGCGAGAATGATAAAATAAAATTGGATATTTGAGAAAAAAA
AAAAAAAAAA

>ALDH1A3_v1_ALDH1A3.aApr07(Source : NCBI - AceView, Homo sapiens)
ATTCCCGAGCGCCGCGAGCCGGCCGAAGTCGGGCGAGCGCGCCGTGCGGCGGCTGGGAGTGGGCTGCATG
TGCCGCGCGGGGAGCCCGCCCGACTTCGGGGAGGCAGCGGGGCGCCGTGGCCCCGCGGCTCAGCTCCCTG
CCGGGTCGGGTGTCCCAGCCCTGCGACTTCCGGGGCCCGGCGGCTCCTCGGGGAGCTCGTCCACAGGCAG
CCTCCGGGGCGAGAGAGCGCGCGGCGCGGGCGCCGGGACGGTCCGCGGCACGCGGGTGGAGCCGCCGGCG
CTCGGGCTCCCGCAGGGGCGGCGGGCGGGGCGGGGTGAGGCGGGCCGGCCGCCCTCCCCTCTCCTCCCTC
CCGCAGCCCGCCCTCCCTTCCTCCGGTCCCGCAGCCAATTAGGCGGCCCCCTCGGGCGGGAGGCGTGGGG
CGCTGCATAAAGCGGCGGGGAGCTGCCACCCCGGGAGCGGGCTGCGCAGTGTCCGGGCCGAGCCGGTGCG
CCGCAGACTAGGGCGCCTCGGGCCAGGGAGCGCGGAGGAGCCATGGCCACCGCTAACGGGGCCGTGGAAA
ACGGGCAGCCGGACAGGAAGCCGCCGGCCCTGCCGCGCCCCATCCGCAACCTGGAGGTCAAGTTCACCAA
GATATTTATCAACAATGAATGGCACGAATCCAAGAGTGGGAAAAAGTTTGCTACATGTAACCCTTCAACT
CGGGAGCAAATATGTGAAGTGGAAGAAGGAGATAAGCCCGACGTGGACAAGGCTGTGGAGGCTGCACAGG
TTGCCTTCCAGAGGGGCTCGCCATGGCGCCGGCTGGATGCCCTGAGTCGTGGGCGGCTGCTGCACCAGCT
GGCTGACCTGGTGGAGAGGGACCGCGCCACCTTGGCCGCCCTGGAGACGATGGATACAGGGAAGCCATTT
CTTCATGCTTTTTTCATCGACCTGGAGGGCTGTATTAGAACCCTCAGATACTTTGCAGGGTGGGCAGACA
AAATCCAGGGCAAGACCATCCCCACAGATGACAACGTCGTGTGCTTCACCAGGCATGAGCCCATTGGTGT
CTGTGGGGCCATCACTCCATGGAACTTCCCCCTGCTGATGCTGGTGTGGAAGCTGGCACCCGCCCTCTGC
TGTGGGAACACCATGGTCCTGAAGCCTGCGGAGCAGACACCTCTCACCGCCCTTTATCTCGGCTCTCTGA
TCAAAGAGGCCGGGTTCCCTCCAGGAGTGGTGAACATTGTGCCAGGATTCGGGCCCACAGTGGGAGCAGC
AATTTCTTCTCACCCTCAGATCAACAAGATCGCCTTCACCGGCTCCACAGAGGTTGGAAAACTGGTTAAA
GAAGCTGCGTCCCGGAGCAATCTGAAGCGGGTGACGCTGGAGCTGGGGGGGAAGAACCCCTGCATCGTGT
GTGCGGACGCTGACTTGGACTTGGCAGTGGAGTGTGCCCATCAGGGAGTGTTCTTCAACCAAGGCCAGTG
TTGCACGGCAGCCTCCAGGGTGTTCGTGGAGGAGCAGGTCTACTCTGAGTTTGTCAGGCGGAGCGTGGAG
TATGCCAAGAAACGGCCCGTGGGAGACCCCTTCGATGTCAAAACAGAACAGGGGCCTCAGATTGATCAAA
AGCAGTTCGACAAAATCTTAGAGCTGATCGAGAGTGGGAAGAAGGAAGGGGCCAAGCTGGAATGCGGGGG
CTCAGCCATGGAAGACAAGGGGCTCTTCATCAAACCCACTGTCTTCTCAGAAGTCACAGACAACATGCGG
ATTGCCAAAGAGGAGATTTTCGGGCCAGTGCAACCAATACTGAAGTTCAAAAGTATCGAAGAAGTGATAA
AAAGAGCGAATAGCACCGACTATGGACTCACAGCAGCCGTGTTCACAAAAAATCTCGACAAAGCCCTGAA
GTTGGCTTCTGCCTTAGAGTCTGGAACGGTCTGGATCAACTGCTACAACGCCCTCTATGCACAGGCTCCA
TTTGGTGGCTTTAAAATGTCAGGAAATGGCAGAGAACTAGGTGAATACGCTTTGGCCGAATACACAGAAG
TGAAAACTGTCACCATCAAACTTGGCGACAAGAACCCCTGAAGGAAAGGCGGGGCTCCTTCCTCAAACAT
CGGACGGCGGAATGTGGCAGATGAAATGTGCTGGAGGAAAAAAATGACATTTCTGACCTTCCCGGGACAC
ATTCTTCTGGAGGCTTTACATCTACTGGAGTTGAATGATTGCTGTTTTCCTCTCACTCTCCTGTTTATTC
ACCAGACTGGGGATGCCTATAGGTTGTCTGTGAAATCGCAGTCCTGCCTGGGGAGGGAGCTGTTGGCCAT
TTCTGTGTTTCCCTTTAAACCAGATCCTGGAGACAGTGAGATACTCAGGGCGTTGTTAACAGGGAGTGGT
ATTTGAAGTGTCCAGCAGTTGCTTGAAATGCTTTGCCGAATCTGACTCCAGTAAGAATGTGGGAAAACCC
CCTGTGTGTTCTGCAAGCAGGGCTCTTGCACCAGCGGTCTCCTCAGGGTGGACCTGCTTACAGAGCAAGC
CACGCCTCTTTCCGAGGTGAAGGTGGGACCATTCCTTGGGAAAGGATTCACAGTAAGGTTTTTTGGTTTT
TGTTTTTTGTTTTCTTGTTTTTAAAAAAAGGATTTCACAGTGAGAAAGTTTTGGTTAGTGCATACCGTGG
AAGGGCGCCAGGGTCTTTGTGGATTGCATGTTGACATTGACCGTGAGATTCGGCTTCAAACCAATACTGC
CTTTGGAATATGACAGAATCAATAGCCCAGAGAGCTTAGTCAAAGACGATATCACGGTCTACCTTAACCA
AGGCACTTTCTTAAGCAGAAAATATTGTTGAGGTTACCTTTGCTGCTAAAGATCCAATCTTCTAACGCCA
CAACAGCATAGCAAATCCTAGGATAATTCACCTCCTCATTTGACAAATCAGAGCTGTAATTCGCTTTAAC
AAATTACGCATTTCTATCACGTTCACTAACAGCTTATGATAAGTCTGTGTAGTCTTCCTTTTCTCCAGTT
CTGTTACCCAATTTAGATTAGTAAAGCGTACACAACTGGAAAGACTGCTGTAATAACACAGCCTTGTTAT
TTTTAAGTCCTATTTTGATATTAATTTCTGATTAGTTAGTAAATAACACCTGGATTCTATGGAGGACCTC
GGTCTTCATCCAAGTGGCCTGAGTATTTCACTGGCAGGTTGTGAATTTTTCTTTTCCTCTTTGGGGATCC
AAATGATGATGTGCAATTTCATGTTTTAACTTGGGAAACTGAAAGTGTTCCCATATAGCTTCAAAAACAA
AAACAAATGTGTTATCCGACGGATACTTTTATGGTTACTAACTAGTACTTTCCTAATTGGGAAAGTAGTG
CTTAAGTTTGCAAATTAAGTTGGGGAGGGCAATAATAAAATGAGGGCCCGTAACAGAACCAGTGTGTGTA
TAACGAAAACCATGTATAAAATGGGCCTATCACCCTTGTCAGAGATATAAATTACCACATTTGCCTTCCC
TTCATCAGCTAACACTTATCACTTATACTACCAATAACTTGTTAAATCAGGATTTGGCTTCATACACTGA
ATTTTCAGTATTTTATCTCAAGTAGATATAGACACTAACCTTGATAGTGATACGTTAGAGGGTTCCTATT
CTTCCATTGTACGATAATGTCTTTAATATGAAATGCTACATTATTTATAATTGGTAGAGTTATTGTATCT
TTTTATAGTTGTAAGTACACAGAGGTGGTATATTTAAACTTCTGTAATATACTGTATTTAGAAATGGAAA
TATATATAGTGTTAGGTTTCACTTCTTTTAAGGTTTACCCCTGTGGTGTGGTTTAAAAATCTATAGGCCT
GGGAATTCCGATCCTAGCTGCAGATCGCATCCCACAATGCGAGAATGATAAAATAAAATTGGATATTTGA
GAAACATTGTG