T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH3A1_v1_ENST00000225740(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
CAGAGGTCCAGAGGACGCCACACCCCACATTTGAATATTTTTTTTTCTTGTCACGCAAACTTCCTGGGCA
GGAACTCCAAGGGCTCAATGGACGGGAAGCAGGGTCCTTAAATACGTCCCCTCTTGGCTCTTGCCGTTCC
AGGAGCCCCAGTTACCGGGAGAGGCTGTGTCAAAGGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGCGC
GCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGC
AGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATG
GAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAG
TGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGC
CACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGG
CGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTG
GCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCA
CGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCAT
GACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGAC
AAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCT
GCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTC
ACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGCAC
TTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCACTC
GCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTCGG
GCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAG
CCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTG
GTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAA
CAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTG
AGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACT
GAGGAGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGCTC
TCCTGGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCTGT
GCACACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAAAG
AGACGAATACAATTTTCTAACTC

>ALDH3A1_v1_ENST00000379258(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
CAGAGGTCCAGAGGACGCCACACCCCACATTTGAATATTTTTTTTTCTTGTCACGCAAACTTCCTGGGCA
GGAACTCCAAGGGCTCAATGGACGGGAAGCAGGGTCCTTAAATACGTCCCCTCTTGGCTCTTGCCGTTCC
AGGAGCCCCAGTTACCGGGAGAGGCTGTGTCAAAGGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGCGC
GCCCGCGCCGCCTTCAGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGCAGCG
CCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATGGAAC
GCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAGTGGG
CCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGCCACT
GGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGGCGCC
ATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTGGCTA
CCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCACGGA
GCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCATGACG
GCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGACAAGA
ACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCTGCGT
GGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTCACTG
AAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGCACTTCC
AGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCACTCGCTA
CATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTCGGGCCT
GTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAGCCCC
TGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTGGTGG
GGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAACAGC
GGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTGAGGC
CTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACTGAGG
AGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGCTCTCCT
GGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCTGTGCAC
ACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAAAGAGAC
GAATACAATTTTCTAACTC

>ALDH3A1_v1_NM_000691(Source : NCBI - GenBank, Homo sapiens)
CCAGGAGCCCCAGTTACCGGGAGAGGCTGTGTCAAAGGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGC
GCGCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCT
GCAGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAA
TGGAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTG
AGTGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGA
GCCACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTG
GGCGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGC
TGGCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGAC
CACGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATC
ATGACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGG
ACAAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGAC
CTGCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAG
TCACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGC
ACTTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCAC
TCGCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTC
GGGCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGA
AGCCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAG
TGGTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGG
AACAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGG
TGAGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCA
CTGAGGAGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGC
TCTCCTGGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCT
GTGCACACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAA
AGAGACGAATACAATTTTCTAACTCAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

>ALDH3A1_v1_ALDH3A1.cApr07(Source : NCBI - AceView, Homo sapiens)
CAGAGGTCCAGAGGACGCCACACCCCACATTTGAATATTTTTTTTTCTTGTCACGCAAACTTCCTGGGCA
GGAACTCCAAGGGCTCAATGGACGGGAAGCAGGGTCCTTAAATACGTCCCCTCTTGGCTCTTGCCGTTCC
AGGAGCCCCAGTTACCGGGAGAGGCTGTGTCAAAGGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGCGC
GCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGC
AGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATG
GAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAG
TGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGC
CACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGG
CGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTG
GCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCA
CGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCAT
GACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGAC
AAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCT
GCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTC
ACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGCAC
TTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCACTC
GCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTCGG
GCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAG
CCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTG
GTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAA
CAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTG
AGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACT
GAGGAGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGCTC
TCCTGGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCTGT
GCACACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAAAG
AGACGAATACAATTTTCTAACTCAGCAAA