T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH3A1_v6_ENST00000395555(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
CGGGAAGCAGGGTCCTTAAATACGTCCCCTCTTGGCTCTTGCCGTTCCAGGAGCCCCAGTTACCGGGAGA
GGCTGTGTCAAAGGCGCCATGAGCAAGATCAGCGAGGCCGTGAAGCGCGCCCGCGCCGCCTTCAGCTCGG
GCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGCAGCGCCTGATCCAGGAGCAGGA
GCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATGGAACGCCTACTATGAGGAGGTG
GTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAGTGGGCCGCGGATGAGCCCGTGG
AGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGCCACTGGGCGTGGTCCTCGTCAT
TGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGGCGCCATCGCTGCAGGGAACTCA
GTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTGGCTACCATCATCCCCCAGTACC
TGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCACGGAGCTGCTCAAGGAGAGGTT
CGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCATGACGGCTGCTGCCAAGCACCTG
ACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGACAAGAACTGTGACCTGGACGTGG
CCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCTGCGTGGCCCCTGACTACATCCT
CTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTCACTGAAAGAGATCTTCGGGCCT
GTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAGCCCC
TGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTGGTGG
GGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAACAGC
GGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTGAGGC
CTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACTGAGG
AGGGGTTGCTCCGCCTGGCCTGGCCATACTGTGTCCCATCGGAGTGCGGACCACCCTCACTGGCTCTCCT
GGCCCTGGGAGAATCGCTCCTGCAGCCCCAGCCCAGCCCCACTCCTCTGCTGACCTGCTGACCTGTGCAC
ACCCCACTCCCACATGGGCCCAGGCCTCACCATTCCAAGTCTCCACCCCTTTCTAGACCAATAAAGAGAC
GAATACAATTTTCTAACTCAGCAAA