T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH3B1_v1_ENST00000007633(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GACATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCT
CAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCA
GCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACG
ACGCACTGGCCCAGGACCTGCACAAGTCAGCCTTCGAGTCGGAGGTGTCTGAGGTTGCCATCAGCCAGGG
CGAGGTCACCCTGGCCCTCAGGAACCGGGCCTGGATGAAGGACGAGCGTGTGCCCAAGAACCTGGCCACG
CAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGGCCTGGTCCTCATCATTGCGCCCTGGAACTATC
CGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTCGCTGCAGGGAACTGTGTGGTGCTGAAGCCATC
GGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGGTGCTGCCCCAATACGTGGACCAGAGCTGCTTT
GCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCTGCTAGAGCACAGGTTCGACTACATCTTCTTCA
CAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCTGGA
GCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTGGCC
TGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGATGC
AGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTCCCC
AAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCCGTGTGGCC
ATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGG
AGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGC
CATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTC
AAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTGG
CCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACAC
CTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCG
CCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGTGGCCATGGAGCAAGGCTGCAGCTGCACACTGCTCT
GAGCCCTTCCCCAGGCCCAGGCTGTAGACCACCATGACAGCTGTCGCCTGCGGCTGGTGGAGACGGGGCC
TGGGCTCCCGGGCCCGAGGAGGAAAAGGATTGCCAAGGCTCCAGGGCACCCCTCAAAGCAGCGCCTGCCT
CCTCCCTCCTGGGTCTTCCCTCTCCCTGCCTCAGCCTCCTCCCTCAGCCGCTCCCAACCATGAGAGCCGA
GGTGGGAGGCATGGGAAACAGTGCAGTGACTCACCCCCTGCCCCCGCACCAACCACCCATATTCAGGAGA
AGAGGACAGACACGGCACCTCTGAGTCACCCCTCTCCTGTGGAGCGGGCGTCCGAGGGGCCCTGGCATCT
GACTCAGGCCACACCATGGAATCACTGCATCCAAGGCCATTCCTGCCCTCTCTGAGTCTCAGTTTTTCCA
TTTGTTCAGTGGAGAGAATTAACCATTGATACCTCCTGGCTGGGTGAGGCGGCTCACACCTGTAATCCCA
GCACTTTGGGAGGCCGAGGCAGGCGGATCACCTGAAATCAGGAGTTCAAGATCAGCCTGGCTAACATGGC
GAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGGCGCATGCCTGTAATCCCAGCTAC
TCAGGAGGCTAAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCCGTGAGCTGAGATTGCGTCA
CTGAACTCCGGCCTGGGTGACAGAAGGAGGCTCTGCCTTAAAAAAAAAAAAAAAAAAAACCTCCTGGGAC
TGTTGCAAGGATGAAATGAAGGATTGAGGGATTGAGGGATTGCTGAGCTGGAGCTCCAGGTGTCCTATCT
TTCTCAGTGGGGTGGCACGGAGCGGGGCCGCCTCCCTCTTCTCTCCAGGCAGGTGGGGCTGTGGTTATGC
GATAGGGTCTCCCTTCCCTCCAGCCCATGCCAGAGGAGCTTGTAACTCTTTATCCTCATGGTGCCCACTA
CGAGTCATACTCTTCCCCATGCTGCTCATCCTCCTGGGCCCCATCCACTCAGCCAAAGCAGAATGCAGGG
TTTCCTGCCTGACAACCCTTCTCACCTCCCAAGTCCCACTTTTGAACAAGCTGATGATTCTGAAACTGGC
CCAATTTCCTAACAAGCCGGATGCTTGAGAAACCTACATTTGGACAATGAGAGGCTGCTCCTGCGGCCTG
CGGGCCACCTCCTCTTCCTTGGCTCCTGCTTTCTTTTTAGACTATATCAACCTACAACTTTAGTCGGGAA
GAGGGACAGGGGTGGACCTGAGTTTCGTCTCCTGTCTCTCTGGCTGATGTCACCTGAATAAAGCCTTCTT
CCCTGGC

>ALDH3B1_v1_NM_000694(Source : NCBI - GenBank, Homo sapiens)
GACATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCT
CAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCA
GCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACG
ACGCACTGGCCCAGGACCTGCACAAGTCAGCCTTCGAGTCGGAGGTGTCTGAGGTTGCCATCAGCCAGGG
CGAGGTCACCCTGGCCCTCAGGAACCTCCGGGCCTGGATGAAGGACGAGCGTGTGCCCAAGAACCTGGCC
ACGCAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGGCCTGGTCCTCATCATTGCGCCCTGGAACT
ATCCGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTCGCTGCAGGGAACTGTGTGGTGCTGAAGCC
ATCGGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGGTGCTGCCCCAATACGTGGACCAGAGCTGC
TTTGCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCTGCTAGAGCACAGGTTCGACTACATCTTCT
TCACAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCT
GGAGCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTG
GCCTGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGA
TGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTC
CCCAAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGT
GTGGCCATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGG
AGATGGAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGA
CGAGGCCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAG
GTGGTCAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGA
CCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTT
CGACACCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGC
TACCCGCCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGTGGCCATGGAGGCCCAAGGCTGCAGCTGCA
CACTGCTCTGAGCCCTTCCCCAGGCCCAGGCTGTAGACCACCATGACAGCTGTCGCCTGCGGCTGGTGGA
GACGGGGCCTGGGCTCCCGGGCCCGAGGAGGAAAAGGATTGCCAAGGCTCCAGGGCACCCCTCAAAGCAG
CGCCTGCCTCCTCCCTCCTGGGTCTTCCCTCTCCCTGCCTCAGCCTCCTCCCTCAGCCGCTCCCAACCAT
GAGAGCCGAGGTGGGAGGCATGGGAAACAGTGCAGTGACTCACCCCCTGCCCCCGCACCAACCACCCATA
TTCAGGAGAAGAGGACAGACACGGCACCTCTGAGTCACCCCTCTCCTGTGGAGCGGGCGTCCGAGGGGCC
CTGGCATCTGACTCAGGCCACACCATGGAATCACTGCATCCAAGGCCATTCCTGCCCTCTCTGAGTCTCA
GTTTTTCCATTTGTTCAGTGGAGAGAATTAACCATTGATACCTCCTGGCTGGGTGAGGCGGCTCACACCT
GTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACCTGAAATCAGGAGTTCAAGATCAGCCTGGC
TAACATGGCGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGGCGCATGCCTGTAAT
CCCAGCTACTCAGGAGGCTAAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCCGTGAGCTGAG
ATTGCGTCACTGAACTCCGGCCTGGGTGACAGAAGGAGGCTCTGCCTTAAAAAAAAAAAAAAAAAAAACC
TCCTGGGACTGTTGCAAGGATGAAATGAAGGATTGAGGGATTGAGGGATTGCTGAGCTGGAGCTCCAGGT
GTCCTATCTTTCTCAGTGGGGTGGCACGGAGCGGGGCCGCCTCCCTCTTCTCTCCAGGCAGGTGGGGCTG
TGGTTATGCGATAGGGTCTCCCTTCCCTCCAGCCCATGCCAGAGGAGCTTGTAACTCTTTATCCTCATGG
TGCCCACTACGAGTCATACTCTTCCCCATGCTGCTCATCCTCCTGGGCCCCATCCACTCAGCCAAAGCAG
AATGCAGGGTTTCCTGCCTGACAACCCTTCTCACCTCCCAAGTCCCACTTTTGAACAAGCTGATGATTCT
GAAACTGGCCCAATTTCCTAACAAGCCGGATGCTTGAGAAACCTACATTTGGACAATGAGAGGCTGCTCC
TGCGGCCTGCGGGCCACCTCCTCTTCCTTGGCTCCTGCTTTCTTTTTAGACTATATCAACCTACAACTTT
AGTCGGGAAGAGGGACAGGGGTGGACCTGAGTTTCGTCTCCTGTCTCTCTGGCTGATGTCACCTGAATAA
AGCCTTCTTCCCTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

>ALDH3B1_v1_ALDH3B1.cApr07(Source : NCBI - AceView, Homo sapiens)
CTGGCCCTGCGTTGGACATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCA
GCTTGGCAGAGCCTCAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGG
GGCGCACGCGGCCAGCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAA
GCAGCTTCTGCACGACGCACTGGCCCAGGACCTGCACAAGTCAGCCTTCGAGTCGGAGGTGTCTGAGGTT
GCCATCAGCCAGGGCGAGGTCACCCTGGCCCTCAGGAACTCCGGGCCTGGATGAAGGACGAGCGTGTGCC
CAAGAACCTGGCCACGCAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGGCCTGGTCCTCATCATT
GCGCCCTGGAACTATCCGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTCGCTGCAGGGAACTGTG
TGGTGCTGAAGCCATCGGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGGTGCTGCCCCAATACGT
GGACCAGAGCTGCTTTGCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCTGCTAGAGCACAGGTTC
GACTACATCTTCTTCACAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCTGCCGCCAAGCACCTGA
CACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACTGCGACCCCCAGACCGT
GGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGCCCCCGACTACGTCCTA
TGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACCCGTTTCTATGGCGACG
ACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGCGGCTGCGGGCATTGCT
GGGCTGCGGCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGCCCCCACGGTGCTGG
TGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTGCCCATCGTGAACGT
GCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCC
AACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCT
TCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGG
CAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTC
AACGCCCTCCGCTACCCGCCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGTGGCCATGGAGGCCAAGG
CTGCAGCTGCACACTGCTCTGAGCCCTTCCCCAGGCCCAGGCTGTAGACCACCATGACAGCTGTCGCCTG
CGGCTGGTGGAGACGGGGCCTGGGCTCCCGGGCCCGAGGAGGAAAAGGATTGCCAAGGCTCCAGGGCACC
CCTCAAAGCAGCGCCTGCCTCCTCCCTCCTGGGTCTTCCCTCTCCCTGCCTCAGCCTCCTCCCTCAGCCG
CTCCCAACCATGAGAGCCGAGGTGGGAGGCATGGGAAACAGTGCAGTGACTCACCCCCTGCCCCCGCACC
AACCACCCATATTCAGGAGAAGAGGACAGACACGGCACCTCTGAGTCACCCCTCTCCTGTGGAGCGGGCG
TCCGAGGGGCCCTGGCATCTGACTCAGGCCACACCATGGAATCACTGCATCCAAGGCCATTCCTGCCCTC
TCTGAGTCTCAGTTTTTCCATTTGTTCAGTGGAGAGAATTAACCATTGATACCTCCTGGCTGGGTGAGGC
GGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACCTGAAATCAGGAGTTCAAG
ATCAGCCTGGCTAACATGGCGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGGCGC
ATGCCTGTAATCCCAGCTACTCAGGAGGCTAAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGC
CGTGAGCTGAGATTGCGTCACTGAACTCCGGCCTGGGTGACAGAAGGAGGCTCTGCCTTAAAAAAAAAAA
AAAAAAAAACCTCCTGGGACTGTTGCAAGGATGAAATGAAGGATTGAGGGATTGAGGGATTGCTGAGCTG
GAGCTCCAGGTGTCCTATCTTTCTCAGTGGGGTGGCACGGAGCGGGGCCGCCTCCCTCTTCTCTCCAGGC
AGGTGGGGCTGTGGTTATGCGATAGGGTCTCCCTTCCCTCCAGCCCATGCCAGAGGAGCTTGTAACTCTT
TATCCTCATGGTGCCCACTACGAGTCATACTCTTCCCCATGCTGCTCATCCTCCTGGGCCCCATCCACTC
AGCCAAAGCAGAATGCAGGGTTTCCTGCCTGACAACCCTTCTCACCTCCCAAGTCCCACTTTTGAACAAG
CTGATGATTCTGAAACTGGCCCAATTTCCTAACAAGCCGGATGCTTGAGAAACCTACATTTGGACAATGA
GAGGCTGCTCCTGCGGCCTGCGGGCCACCTCCTCTTCCTTGGCTCCTGCTTTCTTTTTAGACTATATCAA
CCTACAACTTTAGTCGGGAAGAGGGACAGGGGTGGACCTGAGTTTCGTCTCCTGTCTCTCTGGCTGATGT
CACCTGAATAAAGCCTTCTTCCCTGGCAA

>ALDH3B1_v1_BC013584(Source : NCBI - GenBank, Homo sapiens)
GCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCTCAGGATGGACCCCCTTGGGGACACGCTGCGGC
GACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCAGCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCT
GGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACGACGCACTGGCCCAGGACCTGCACAAGTCAGCC
TTCGAGTCGGAGGTGTCTGAGGTTGCCATCAGCCAGGGCGAGGTCACCCTGGCCCTCAGGAACCTCCGGG
CCTGGATGAAGGACGAGCGTGTGCCCAAGAACCTGGCCACGCAGCTGGACTCCGCCTTCATCCGGAAGGA
GCCCTTTGGCCTGGTCCTCATCATTGCGCCCTGGAACTATCCGCTGAACCTGACGCTGGTGCCCCTCGTG
GGAGCCCTCGCTGCAGGGAACTGTGTGGTGCTGAAGCCATCGGAGATTAGCAAGAACGTCGAGAAGATCC
TGGCCGAGGTGCTGCCCCAATACGTGGACCAGAGCTGCTTTGCTGTGGTGCTGGGCGGGCCCCAGGAGAC
GGGGCAGCTGCTAGAGCACAGGTTCGACTACATCTTCTTCACAGGGAGCCCTCGTGTGGGCAAGATTGTT
ATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGG
ACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGAC
CTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGC
ACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAAC
AGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGA
TCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTC
GGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGA
AGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAG
CGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGT
GCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCC
TGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCGCGCCGCCTGAGGAT
GCTGCTGGTGGCCATGGAGGCCCAAGGCTGCAGCTGCACACTGCTCTGAGCCCTTCCCCAGGCCCAGGCT
GTAGACCACCATGACAGCTGTCGCCTGCGGCTGGTGGAGACGGGGCCTGGGCTCCCGGGCCCGAGGAGGA
AAAGGATTGCCAAGGCTCCAGGGCACCCCTCAAAGCAGCGCCTGCCTCCTCCCTCCTGGGTCTTCCCTCT
CCCTGCCTCAGCCTCCTCCCTCAGCCGCTCCCAACCATGAGAGCCGAGGTGGGAGGCATGGGAAACAGTG
CAGTGACTCACCCCCTGCCCCCGCACCAACCACCCATATTCAGGAGAAGAGGACAGACACGGCACCTCTG
AGTCACCCCTCTCCTGTGGAGCGGGCGTCCGAGGGGCCCTGGCATCTGACTCAGGCCACACCATGGAATC
ACTGCATCCAAGGCCATTCCTGCCCTCTCTGAGTCTCAGTTTTTCCATTTGTTCAGTGGAGAGAATTAAC
CATTGATACCTCCTGGCTGGGTGAGGCGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGG
CGGATCACCTGAAATCAGGAGTTCAAGATCAGCCTGGCTAACATGGCGAAACCCCGTCTCTACTAAAAAT
ACAAAAATTAGCCTGGCGTGGTGGCGCATGCCTGTAATCCCAGCTACTCAGGAGGCTAAGGCAGGAGAAT
CGCTTGAACCCGGGAGGTGGAGGTTGCCGTGAGCTGAGATTGCGTCACTGAACTCCGGCCTGGGTGACAG
AAGGAGGCTCTGCCTTAAAAAAAAAAAAAAAAAAAACCTCCTGGGACTGTTGCAAGGATGAAATGAAGGA
TTGAGGGATTGAGGGATTGCTGAGCTGGAGCTCCAGGTGTCCTATCTTTCTCAGTGGGGTGGCACGGAGC
GGGGCCGCCTCCCTCTTCTCTCCAGGCAGGTGGGGCTGTGGTTATGCGATAGGGTCTCCCTTCCCTCCAG
CCCATGCCAGAGGAGCTTGTAACTCTTTATCCTCATGGTGCCCACTACGAGTCATACTCTTCCCCATGCT
GCTCATCCTCCTGGGCCCCATCCACTCAGCCAAAGCAGAATGCAGGGTTTCCTGCCTGACAACCCTTCTC
ACCTCCCAAGTCCCACTTTTGAACAAGCTGATGATTCTGAAACTGGCCCAATTTCCTAACAAGCCGGATG
CTTGAGAAACCTACATTTGGACAATGAGAGGCTGCTCCTGCGGCCTGCGGGCCACCTCCTCTTCCTTGGC
TCCTGCTTTCTTTTTAGACTATATCAACCTACAACTTTAGTCGGGAAGAGGGACAGGGGTGGACCTGAGT
TTCGTCTCCTGTCTCTCTGGCTGATGTCACCTGAATAAAGCCTTCTTCCCTGGCAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA