T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH3B1_v2_ENST00000342456(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GACATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCT
CAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCA
GCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACG
ACGCACTGGCCCAGGACCTGCACAAGGCCACGCAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGG
CCTGGTCCTCATCATTGCGCCCTGGAACTATCCGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTC
GCTGCAGGGAACTGTGTGGTGCTGAAGCCATCGGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGG
TGCTGCCCCAATACGTGGACCAGAGCTGCTTTGCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCT
GCTAGAGCACAGGTTCGACTACATCTTCTTCACAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCT
GCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACT
GCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGC
CCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACC
CGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGC
GGCTGCGGGCATTGCTGGGCTGCCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGC
CCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTG
CCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCC
TGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTG
TGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATG
GGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGG
GGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGTGGC
CATGGAGCAAGGCTGCAGCTGCACACTGCTCTGAGCCCTTCCCCAGGCCCAGGCTGTAGACCACCATGAC
AGCTGTCGCCTGCGGCTGGTGGAGACGGGGCCTGGGCTCCCGGGCCCGAGGAGGAAAAGGATTGCCAAGG
CTCCAGGGCACCCCTCAAAGCAGCGCCTGCCTCCTCCCTCCTGGGTCTTCCCTCTCCCTGCCTCAGCCTC
CTCCCTCAGCCGCTCCCAACCATGAGAGCCGAGGTGGGAGGCATGGGAAACAGTGCAGTGACTCACCCCC
TGCCCCCGCACCAACCACCCATATTCAGGAGAAGAGGACAGACACGGCACCTCTGAGTCACCCCTCTCCT
GTGGAGCGGGCGTCCGAGGGGCCCTGGCATCTGACTCAGGCCACACCATGGAATCACTGCATCCAAGGCC
ATTCCTGCCCTCTCTGAGTCTCAGTTTTTCCATTTGTTCAGTGGAGAGAATTAACCATTGATACCTCCTG
GCTGGGTGAGGCGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACCTGAAAT
CAGGAGTTCAAGATCAGCCTGGCTAACATGGCGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCTG
GCGTGGTGGCGCATGCCTGTAATCCCAGCTACTCAGGAGGCTAAGGCAGGAGAATCGCTTGAACCCGGGA
GGTGGAGGTTGCCGTGAGCTGAGATTGCGTCACTGAACTCCGGCCTGGGTGACAGAAGGAGGCTCTGCCT
TAAAAAAAAAAAAAAAAAAAACCTCCTGGGACTGTTGCAAGGATGAAATGAAGGATTGAGGGATTGAGGG
ATTGCTGAGCTGGAGCTCCAGGTGTCCTATCTTTCTCAGTGGGGTGGCACGGAGCGGGGCCGCCTCCCTC
TTCTCTCCAGGCAGGTGGGGCTGTGGTTATGCGATAGGGTCTCCCTTCCCTCCAGCCCATGCCAGAGGAG
CTTGTAACTCTTTATCCTCATGGTGCCCACTACGAGTCATACTCTTCCCCATGCTGCTCATCCTCCTGGG
CCCCATCCACTCAGCCAAAGCAGAATGCAGGGTTTCCTGCCTGACAACCCTTCTCACCTCCCAAGTCCCA
CTTTTGAACAAGCTGATGATTCTGAAACTGGCCCAATTTCCTAACAAGCCGGATGCTTGAGAAACCTACA
TTTGGACAATGAGAGGCTGCTCCTGCGGCCTGCGGGCCACCTCCTCTTCCTTGGCTCCTGCTTTCTTTTT
AGACTATATCAACCTACAACTTTAGTCGGGAAGAGGGACAGGGGTGGACCTGAGTTTCGTCTCCTGTCTC
TCTGGCTGATGTCACCTGAATAAAGCCTTCTTCCCTGGC

>ALDH3B1_v2_NM_001030010(Source : NCBI - GenBank, Homo sapiens)
GACATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCT
CAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCA
GCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACG
ACGCACTGGCCCAGGACCTGCACAAGGCCACGCAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGG
CCTGGTCCTCATCATTGCGCCCTGGAACTATCCGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTC
GCTGCAGGGAACTGTGTGGTGCTGAAGCCATCGGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGG
TGCTGCCCCAATACGTGGACCAGAGCTGCTTTGCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCT
GCTAGAGCACAGGTTCGACTACATCTTCTTCACAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCT
GCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACT
GCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGC
CCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACC
CGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGC
GGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGATCGCTACAT
CGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATC
CTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGG
CCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTT
CTGTGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGG
ATGGGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCC
CGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGT
GGCCATGGAGGCCCAAGGCTGCAGCTGCACACTGCTCTGAGCCCTTCCCCAGGCCCAGGCTGTAGACCAC
CATGACAGCTGTCGCCTGCGGCTGGTGGAGACGGGGCCTGGGCTCCCGGGCCCGAGGAGGAAAAGGATTG
CCAAGGCTCCAGGGCACCCCTCAAAGCAGCGCCTGCCTCCTCCCTCCTGGGTCTTCCCTCTCCCTGCCTC
AGCCTCCTCCCTCAGCCGCTCCCAACCATGAGAGCCGAGGTGGGAGGCATGGGAAACAGTGCAGTGACTC
ACCCCCTGCCCCCGCACCAACCACCCATATTCAGGAGAAGAGGACAGACACGGCACCTCTGAGTCACCCC
TCTCCTGTGGAGCGGGCGTCCGAGGGGCCCTGGCATCTGACTCAGGCCACACCATGGAATCACTGCATCC
AAGGCCATTCCTGCCCTCTCTGAGTCTCAGTTTTTCCATTTGTTCAGTGGAGAGAATTAACCATTGATAC
CTCCTGGCTGGGTGAGGCGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACC
TGAAATCAGGAGTTCAAGATCAGCCTGGCTAACATGGCGAAACCCCGTCTCTACTAAAAATACAAAAATT
AGCCTGGCGTGGTGGCGCATGCCTGTAATCCCAGCTACTCAGGAGGCTAAGGCAGGAGAATCGCTTGAAC
CCGGGAGGTGGAGGTTGCCGTGAGCTGAGATTGCGTCACTGAACTCCGGCCTGGGTGACAGAAGGAGGCT
CTGCCTTAAAAAAAAAAAAAAAAAAAACCTCCTGGGACTGTTGCAAGGATGAAATGAAGGATTGAGGGAT
TGAGGGATTGCTGAGCTGGAGCTCCAGGTGTCCTATCTTTCTCAGTGGGGTGGCACGGAGCGGGGCCGCC
TCCCTCTTCTCTCCAGGCAGGTGGGGCTGTGGTTATGCGATAGGGTCTCCCTTCCCTCCAGCCCATGCCA
GAGGAGCTTGTAACTCTTTATCCTCATGGTGCCCACTACGAGTCATACTCTTCCCCATGCTGCTCATCCT
CCTGGGCCCCATCCACTCAGCCAAAGCAGAATGCAGGGTTTCCTGCCTGACAACCCTTCTCACCTCCCAA
GTCCCACTTTTGAACAAGCTGATGATTCTGAAACTGGCCCAATTTCCTAACAAGCCGGATGCTTGAGAAA
CCTACATTTGGACAATGAGAGGCTGCTCCTGCGGCCTGCGGGCCACCTCCTCTTCCTTGGCTCCTGCTTT
CTTTTTAGACTATATCAACCTACAACTTTAGTCGGGAAGAGGGACAGGGGTGGACCTGAGTTTCGTCTCC
TGTCTCTCTGGCTGATGTCACCTGAATAAAGCCTTCTTCCCTGGCAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA

>ALDH3B1_v2_ALDH3B1.aApr07(Source : NCBI - AceView, Homo sapiens)
ATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCTCAG
GATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCAGCT
GAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACGACG
CACTGGCCCAGGACCTGCACAAGGCCACGCAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGGCCT
GGTCCTCATCATTGCGCCCTGGAACTATCCGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTCGCT
GCAGGGAACTGTGTGGTGCTGAAGCCATCGGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGGTGC
TGCCCCAATACGTGGACCAGAGCTGCTTTGCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCTGCT
AGAGCACAGGTTCGACTACATCTTCTTCACAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCTGCC
GCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACTGCG
ACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGCCCC
CGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACCCGT
TTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGCGGC
TGCGGGCATTGCTGGGCTGCGGCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGCC
CCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTGC
CCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCCT
GTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTGT
GGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATGG
GCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGGG
GATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGTGGCC
ATGGAGGCCAAGGCTGCAGCTGCACACTGCTCTGAGCCCTTCCCCAGGCCCAGGCTGTAGACCACCATGA
CAGCTGTCGCCTGCGGCTGGTGGAGACGGGGCCTGGGCTCCCGGGCCCGAGGAGGAAAAGGATTGCCAAG
GCTCCAGGGCACCCCTCAAAGCAGCGCCTGCCTCCTCCCTCCTGGGTCTTCCCTCTCCCTGCCTCAGCCT
CCTCCCTCAGCCGCTCCCAACCATGAGAGCCGAGGTGGGAGGCATGGGAAACAGTGCAGTGACTCACCCC
CTGCCCCCGCACCAACCACCCATATTCAGGAGAAGAGGACAGACACGGCACCTCTGAGTCACCCCTCTCC
TGTGGAGCGGGCGTCCGAGGGGCCCTGGCATCTGACTCAGGCCACACCATGGAATCACTGCATCCAAGGC
CATTCCTGCCCTCTCTGAGTCTCAGTTTTTCCATTTGTTCAGTGGAGAGAATTAACCATTGATACCTCCT
GGCTGGGTGAGGCGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACCTGAAA
TCAGGAGTTCAAGATCAGCCTGGCTAACATGGCGAAACCCCGTCTCTACTAAAAATACAAAAATTAGCCT
GGCGTGGTGGCGCATGCCTGTAATCCCAGCTACTCAGGAGGCTAAGGCAGGAGAATCGCTTGAACCCGGG
AGGTGGAGGTTGCCGTGAGCTGAGATTGCGTCACTGAACTCCGGCCTGGGTGACAGAAGGAGGCTCTGCC
TTAAAAAAAAAAAAAAAAAAAACCTCCTGGGACTGTTGCAAGGATGAAATGAAGGATTGAGGGATTGAGG
GATTGCTGAGCTGGAGCTCCAGGTGTCCTATCTTTCTCAGTGGGGTGGCACGGAGCGGGGCCGCCTCCCT
CTTCTCTCCAGGCAGGTGGGGCTGTGGTTATGCGATAGGGTCTCCCTTCCCTCCAGCCCATGCCAGAGGA
GCTTGTAACTCTTTATCCTCATGGTGCCCACTACGAGTCATACTCTTCCCCATGCTGCTCATCCTCCTGG
GCCCCATCCACTCAGCCAAAGCAGAATGCAGGGTTTCCTGCCTGACAACCCTTCTCACCTCCCAAGTCCC
ACTTTTGAACAAGCTGATGATTCTGAAACTGGCCCAATTTCCTAACAAGCCGGATGCTTGAGAAACCTAC
ATTTGGACAATGAGAGGCTGCTCCTGCGGCCTGCGGGCCACCTCCTCTTCCTTGGCTCCTGCTTTCTTTT
TAGACTATATCAACCTACAACTTTAGTCGGGAAGAGGGACAGGGGTGGACCTGAGTTTCGTCTCCTGTCT
CTCTGGCTGATGTCACCTGAATAAAGCCTTCTTCCCTGGCAA

>ALDH3B1_v2_BC033099(Source : NCBI - GenBank, Homo sapiens)
GGAAGGGCAGCTTGGCAGAGCCTCAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCT
TCCACGCGGGGCGCACGCGGCCAGCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCA
AGAAAACAAGCAGCTTCTGCACGACGCACTGGCCCAGGACCTGCACAAGGCCACGCAGCTGGACTCCGCC
TTCATCCGGAAGGAGCCCTTTGGCCTGGTCCTCATCATTGCGCCCTGGAACTATCCGCTGAACCTGACGC
TGGTGCCCCTCGTGGGAGCCCTCGCTGCAGGGAACTGTGTGGTGCTGAAGCCATCGGAGATTAGCAAGAA
CGTCGAGAAGATCCTGGCCGAGGTGCTGCCCCAATACGTGGACCAGAGCTGCTTTGCTGTGGTGCTGGGC
GGGCCCCAGGAGACGGGGCAGCTGCTAGAGCACAGGTTCGACTACATCTTCTTCACAGGGAGCCCTCGTG
TGGGCAAGATTGTTATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAA
CCCTTGCTACGTGGACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTC
AACGCCGGCCAGACCTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGC
CTGCCCTGCAGAGCACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCAT
CATCAACCAGAAACAGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGCCATTGGGGGCCAG
AGCGATGAGAGCGATCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGC
AGGAGGAGATCTTCGGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCAT
CAACCGGCGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTG
ACCCAGACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTT
TTGGAGGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCA
TCGCGCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCG
CGCCGCCTGAGGATGCTGCTGGTGGCCATGGAGGCCCAAGGCTGCAGCTGCACACTGCTCTGAGCCCTTC
CCCAGGCCCAGGCTGTAGACCACCATGACAGCTGTCGCCTGCGGCTGGTGGAGACGGGGCCTGGGCTCCC
GGGCCCGAGGAGGAAAAGGATTGCCAAGGCTCCAGGGCACCCCTCAAAGCAGCGCCTGCCTCCTCCCTCC
TGGGTCTTCCCTCTCCCTGCCTCAGCCTCCTCCCTCAGCCGCTCCCAACCATGAGAGCCGAGGTGGGAGG
CATGGGAAACAGTGCAGTGACTCACCCCCTGCCCCCGCACCAACCACCCATATTCAGGAGAAGAGGACAG
ACACGGCACCTCTGAGTCACCCCTCTCCTGTGGAGCGGGCGTCCGAGGGGCCCTGGCATCTGACTCAGGC
CACACCATGGAATCACTGCATCCAAGGCCATTCCTGCCCTCTCTGAGTCTCAGTTTTTCCATTTGTTCAG
TGGAGAGAATTAACCATTGATACCTCCTGGCTGGGTGAGGCGGCTCACACCTGTAATCCCAGCACTTTGG
GAGGCCGAGGCAGGCGGATCACCTGAAATCAGGAGTTCAAGATCAGCCTGGCTAACATGGCGAAACCCCG
TCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGGCGCATGCCTGTAATCCCAGCTACTCAGGAGGC
TAAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCCGTGAGCTGAGATTGCGTCACTGAACTCC
GGCCTGGGTGACAGAAGGAGGCTCTGCCTTAAAAAAAAAAAAAAAAAA