T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH8A1_v1_ENST00000265605(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTATGGCTGGAACAAACGC
ACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATATATAGATTCTTACGAC
CCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCGAAGCCGCGGTCAAGG
CCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACGGGTCCTGAACCAGGT
GGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGACCAAGGGAAAACCTTA
GCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCGCTTCCTCCAGCCTGC
ACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGTGCGGGCCCCGGTGGG
AGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAGATAGCTCCAGCGATG
GCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGTGGATGTTGTGCAAAC
TCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGGGCCCAGGGTGGGTGA
GGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCCACCGCTGAGCGGATC
ACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGAATCCTGCCATCATCT
TTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGCCAACCAGGGTGAAAT
CTGTCTCTGTACCAGCAGGATCTTTGTCCAGAAGAGCATCTATAGTGAATTTTTAAAGAGATTTGTAGAA
GCTACCAGAAAGTGGAAAGTCGGCATTCCCTCTGATCCACTGGTGAGCATAGGTGCTCTGATAAGTAAAG
CACATTTGGAGAAAGTCAGAAGTTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCAAATTTGGTGCGGTGA
GGGAGTGGATAAGTTGAGCCTCCCTGCCAGGAACCAGGCAGGCTACTTTATGCTTCCCACGGTGATAACA
GACATTAAGGATGAATCCTGCTGCATGACGGAAGAGATATTTGGTCCAGTGACGTGTGTCGTCCCCTTTG
ATAGTGAAGAGGAGGTGATTGAAAGAGCCAACAACGTTAAGTATGGGCTGGCGGCTACCGTGTGGTCCAG
CAATGTGGGGCGCGTCCACCGGGTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGGACCAACTGCTGGCTC
ATCAGGGAGCTGAACCTTCCTTTCGGGGGGATGAAGAGTTCTGGAATAGGTAGAGAGGGAGCCAAGGACT
CTTACGACTTCTTCACTGAGATCAAAACCATCACCGTTAAACACTGATCTTTGCTAATGGTGGAGCCACT
ATGGCCAATGCCTGGCTGCAGGCATCAGTTGTTCAATGTGGTAGATGAAAATCATGGCATGAATTCCAGC
TATGCCTTGACTTGGCAGAAGGTTATCTCTAGCTTATCCTCAGTTCTTAGTAACTTTACCCACTAGTGAA
GAGATACTGTCTATTTTCAATGTGGACTCGGAAAAAAAGACTTATAAGTAGGAAGATAGAACAATGATGC
CAGTTGTCAGGCTCCTCCCAGGTTATGTTTTCATAGTGTTTCTTTCATCATCTTCATTGAACTCTTGGGA
ATCTCCAGATAATCAGATTATTTCATTTGGTAAATTTTAAAAAATATGCAATCAGGCACAGTGCCTCATG
CCTATAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACTTGAGTTCAGGAGTTCGAGATCAGCCT
AGGCAACATGGTGAAATCCTGTCTTTACCAAAAGTTTAAAAATTAGCTTGGTGTGGTGCCCTCTGCCTAT
AGCCCCAGCTACTTGGGAGGCTGAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTGAGGCTGCAGTGAGCC
ATGATCATTCCACTGCATTTCAGCCTGGGGGATACAGTGAGACCTTGTCTTTAAAAAAAAAATGCTGCAA
AACCAAAAATAAATAGCCATAATTTGCCATCTTTGGAGAGATTATGGAGATAATCTCCTTGTCTATTAGC
CACTAGCATGGCTAATTGATCATTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTT
GTTAGGGGAAGGCTATGTGGTAAGCTCTACTAAATGTATCTGTACAAGGATGAAGAAAAACAAAATAACT
ACTACTTTTGGAGGAAACTTGGAACAAGAAGAGTACATAGTTTGATCCATTCCTACGGTCGAGTCTAATC
AATTCCATTTCTTAGTGTATGCATCTAATGAGGCTTACAACTTGCTAACCCCAAAAGAAGCAATAAATGT
TAAGCAATTTTAGTAACCAGT

>ALDH8A1_v1_ENST00000367847(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTATGGCTGGAACAAACGC
ACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATATATAGATTCTTACGAC
CCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCGAAGCCGCGGTCAAGG
CCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACGGGTCCTGAACCAGGT
GGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGACCAAGGGAAAACCTTA
GCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCGCTTCCTCCAGCCTGC
ACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGTGCGGGCCCCGGTGGG
AGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAGATAGCTCCAGCGATG
GCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGTGGATGTTGTGCAAAC
TCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGGGCCCAGGGTGGGTGA
GGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCCACCGCTGAGCGGATC
ACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGAATCCTGCCATCATCT
TTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGCCAACCAGGGTGAAAT
CTGTCTCTGTACCAGCAGGATCTTTGTCCAGAAGAGCATCTATAGTGAATTTTTAAAGAGATTTGTAGAA
GCTACCAGAAAGTGGAAAGTCGGCATTCCCTCTGATCCACTGGTGAGCATAGGTGCTCTGATAAGTAAAG
CACATTTGGAGAAAGTCAGAAGTTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCAAATTTGGTGCGGTGA
GGGAGTGGATAAGTTGAGCCTCCCTGCCAGGAACCAGGCAGGCTACTTTATGCTTCCCACGGTGATAACA
GACATTAAGGATGAATCCTGCTGCATGACGGAAGAGATATTTGGTCCAGTGACGTGTGTCGTCCCCTTTG
ATAGTGAAGAGGAGGTGATTGAAAGAGCCAACAACGTTAAGTATGGGCTGGCGGCTACCGTGTGGTCCAG
CAATGTGGGGCGCGTCCACCGGGTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGGACCAACTGCTGGCTC
ATCAGGGAGCTGAACCTTCCTTTCGGGGGGATGAAGAGTTCTGGAATAGGTAGAGAGGGAGCCAAGGACT
CTTACGACTTCTTCACTGAGATCAAAACCATCACCGTTAAACACTGATCTTTGCTAATGGTGGAGCCACT
ATGGCCAATGCCTGGCTGCAGGCATCAGTTGTTCAATGTGGTAGATGAAAATCATGGCATGAATTCCAGC
TATGCCTTGACTTGGCAGAAGGTTATCTCTAGCTTATCCTCAGTTCTTAGTAACTTTACCCACTAGTGAA
GAGATACTGTCTATTTTCAATGTGGACTCGGAAAAAAAGACTTATAAGTAGGAAGATAGAACAATGATGC
CAGTTGTCAGGCTCCTCCCAGGTTATGTTTTCATAGTGTTTCTTTCATCATCTTCATTGAACTCTTGGGA
ATCTCCAGATAATCAGATTATTTCATTTGGTAAATTTTAAAAAATATGCAATCAGGCACAGTGCCTCATG
CCTATAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACTTGAGTTCAGGAGTTCGAGATCAGCCT
AGGCAACATGGTGAAATCCTGTCTTTACCAAAAGTTTAAAAATTAGCTTGGTGTGGTGCCCTCTGCCTAT
AGCCCCAGCTACTTGGGAGGCTGAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTGAGGCTGCAGTGAGCC
ATGATCATTCCACTGCATTTCAGCCTGGGGGATACAGTGAGACCTTGTCTTTAAAAAAAAAATGCTGCAA
AACCAAAAATAAATAGCCATAATTTGCCATCTTTGGAGAGATTATGGAGATAATCTCCTTGTCTATTAGC
CACTAGCATGGCTAATTGATCATTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTT
GTTAGGGGAAGGCTATGTGGTAAGCTCTACTAAATGTATCTGTACAAGGATGAAGAAAAACAAAATAACT
ACTACTTTTGGAGGAAACTTGGAACAAGAAGAGTACATAGTTTGATCCATTCCTACGGTCGAGTCTAATC
AATTCCATTTCTTAGTGTATGCATCTAATGAGGCTTACAACTTGCTAACCCCAAAAGAAGCAATAAATGT
TAAGCAATTTTAGTAA

>ALDH8A1_v1_NM_022568(Source : NCBI - GenBank, Homo sapiens)
GGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTATGGCTGGAACAAACGC
ACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATATATAGATTCTTACGAC
CCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCGAAGCCGCGGTCAAGG
CCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACGGGTCCTGAACCAGGT
GGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGACCAAGGGAAAACCTTA
GCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCGCTTCCTCCAGCCTGC
ACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGTGCGGGCCCCGGTGGG
AGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAGATAGCTCCAGCGATG
GCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGTGGATGTTGTGCAAAC
TCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGGGCCCAGGGTGGGTGA
GGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCCACCGCTGAGCGGATC
ACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGAATCCTGCCATCATCT
TTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGCCAACCAGGGTGAAAT
CTGTCTCTGTACCAGCAGGATCTTTGTCCAGAAGAGCATCTATAGTGAATTTTTAAAGAGATTTGTAGAA
GCTACCAGAAAGTGGAAAGTCGGCATTCCCTCTGATCCACTGGTGAGCATAGGTGCTCTGATAAGTAAAG
CACATTTGGAGAAAGTCAGAAGTTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCAAATTTGGTGCGGTGA
GGGAGTGGATAAGTTGAGCCTCCCTGCCAGGAACCAGGCAGGCTACTTTATGCTTCCCACGGTGATAACA
GACATTAAGGATGAATCCTGCTGCATGACGGAAGAGATATTTGGTCCAGTGACGTGTGTCGTCCCCTTTG
ATAGTGAAGAGGAGGTGATTGAAAGAGCCAACAACGTTAAGTATGGGCTGGCGGCTACCGTGTGGTCCAG
CAATGTGGGGCGCGTCCACCGGGTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGGACCAACTGCTGGCTC
ATCAGGGAGCTGAACCTTCCTTTCGGGGGGATGAAGAGTTCTGGAATAGGTAGAGAGGGAGCCAAGGACT
CTTACGACTTCTTCACTGAGATCAAAACCATCACCGTTAAACACTGATCTTTGCTAATGGTGGAGCCACT
ATGGCCAATGCCTGGCTGCAGGCATCAGTTGTTCAATGTGGTAGATGAAAATCATGGCATGAATTCCAGC
TATGCCTTGACTTGGCAGAAGGTTATCTCTAGCTTATCCTCAGTTCTTAGTAACTTTACCCACTAGTGAA
GAGATACTGTCTATTTTCAATGTGGACTCGGAAAAAAAGACTTATAAGTAGGAAGATAGAACAATGATGC
CAGTTGTCAGGCTCCTCCCAGGTTATGTTTTCATAGTGTTTCTTTCATCATCTTCATTGAACTCTTGGGA
ATCTCCAGATAATCAGATTATTTCATTTGGTAAATTTTAAAAAATATGCAATCAGGCACAGTGCCTCATG
CCTATAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACTTGAGTTCAGGAGTTCGAGATCAGCCT
AGGCAACATGGTGAAATCCTGTCTTTACCAAAAGTTTAAAAATTAGCTTGGTGTGGTGCCCTCTGCCTAT
AGCCCCAGCTACTTGGGAGGCTGAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTGAGGCTGCAGTGAGCC
ATGATCATTCCACTGCATTTCAGCCTGGGGGATACAGTGAGACCTTGTCTTTAAAAAAAAAATGCTGCAA
AACCAAAAATAAATAGCCATAATTTGCCATCTTTGGAGAGATTATGGAGATAATCTCCTTGTCTATTAGC
CACTAGCATGGCTAATTGATCATTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTT
GTTAGGGGAAGGCTATGTGGTAAGCTCTACTAAATGTATCTGTACAAGGATGAAGAAAAACAAAATAACT
ACTACTTTTGGAGGAAACTTGGAACAAGAAGAGTACATAGTTTGATCCATTCCTACGGTCGAGTCTAATC
AATTCCATTTCTTAGTGTATGCATCTAATGAGGCTTACAACTTGCTAACCCCAAAAGAAGCAATAAATGT
TAAGCAATTTTAGTAACCAGTAAAAAAAA

>ALDH8A1_v1_HBS1LandALDH8A1.dApr07(Source : NCBI - AceView, Homo sapiens)
GTCCAGACAGTGGTGGGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTAT
GGCTGGAACAAACGCACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATAT
ATAGATTCTTACGACCCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCG
AAGCCGCGGTCAAGGCCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACG
GGTCCTGAACCAGGTGGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGAC
CAAGGGAAAACCTTAGCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCG
CTTCCTCCAGCCTGCACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGT
GCGGGCCCCGGTGGGAGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAG
ATAGCTCCAGCGATGGCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGT
GGATGTTGTGCAAACTCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGG
GCCCAGGGTGGGTGAGGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCC
ACCGCTGAGCGGATCACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGA
ATCCTGCCATCATCTTTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGC
CAACCAGGGTGAAATCTGTCTCTGTACCAGCAGGATCTTTGTCCAGAAGAGCATCTATAGTGAATTTTTA
AAGAGATTTGTAGAAGCTACCAGAAAGTGGAAAGTCGGCATTCCCTCTGATCCACTGGTGAGCATAGGTG
CTCTGATAAGTAAAGCACATTTGGAGAAAGTCAGAAGTTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCA
AATTTGGTGCGGTGAGGGAGTGGATAAGTTGAGCCTCCCTGCCAGGAACCAGGCAGGCTACTTTATGCTT
CCCACGGTGATAACAGACATTAAGGATGAATCCTGCTGCATGACGGAAGAGATATTTGGTCCAGTGACGT
GTGTCGTCCCCTTTGATAGTGAAGAGGAGGTGATTGAAAGAGCCAACAACGTTAAGTATGGGCTGGCGGC
TACCGTGTGGTCCAGCAATGTGGGGCGCGTCCACCGGGTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGG
ACCAACTGCTGGCTCATCAGGGAGCTGAACCTTCCTTTCGGGGGGATGAAGAGTTCTGGAATAGGTAGAG
AGGGAGCCAAGGACTCTTACGACTTCTTCACTGAGATCAAAACCATCACCGTTAAACACTGATCTTTGCT
AATGGTGGAGCCACTATGGCCAATGCCTGGCTGCAGGCATCAGTTGTTCAATGTGGTAGATGAAAATCAT
GGCATGAATTCCAGCTATGCCTTGACTTGGCAGAAGGTTATCTCTAGCTTATCCTCAGTTCTTAGTAACT
TTACCCACTAGTGAAGAGATACTGTCTATTTTCAATGTGGACTCGGAAAAAAAGACTTATAAGTAGGAAG
ATAGAACAATGATGCCAGTTGTCAGGCTCCTCCCAGGTTATGTTTTCATAGTGTTTCTTTCATCATCTTC
ATTGAACTCTTGGGAATCTCCAGATAATCAGATTATTTCATTTGGTAAATTTTAAAAAATATGCAATCAG
GCACAGTGCCTCATGCCTATAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACTTGAGTTCAGGA
GTTCGAGATCAGCCTAGGCAACATGGTGAAATCCTGTCTTTACCAAAAGTTTAAAAATTAGCTTGGTGTG
GTGCCCTCTGCCTATAGCCCCAGCTACTTGGGAGGCTGAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTG
AGGCTGCAGTGAGCCATGATCATTCCACTGCATTTCAGCCTGGGGGATACAGTGAGACCTTGTCTTTAAA
AAAAAAATGCTGCAAAACCAAAAATAAATAGCCATAATTTGCCATCTTTGGAGAGATTATGGAGATAATC
TCCTTGTCTATTAGCCACTAGCATGGCTAATTGATCATTGATTGGACCTCATTACATAAGGGGGCTGTGG
ACGTCTTTGGAATTTGTTAGGGGAAGGCTATGTGGTAAGCTCTACTAAATGTATCTGTACAAGGATGAAG
AAAAACAAAATAACTACTACTTTTGGAGGAAACTTGGAACAAGAAGAGTACATAGTTTGATCCATTCCTA
CGGTCGAGTCTAATCAATTCCATTTCTTAGTGTATGCATCTAATGAGGCTTACAACTTGCTAACCCCAAA
AGAAGCAATAAATGTTAAGCAATTTTAGTAACCAGTATGGCATGTATCTTATTTTTGAATGCATTCCTCC
TTATCCCCATCCTCTTAGGAATATGGACGTTTTACTAAGTAATAAAGATTTCAAATGCT