T Coffee Server (Multiple Sequence Alignment @ EMBL EBI)

ClustalW2 Server (Multiple Sequence Alignment @ EMBL EBI)

Pfam Database Server (Protein Families @ Wellcome Trust Sanger Institute)


>ALDH8A1_v2_ENST00000349305(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTATGGCTGGAACAAACGC
ACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATATATAGATTCTTACGAC
CCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCGAAGCCGCGGTCAAGG
CCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACGGGTCCTGAACCAGGT
GGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGACCAAGGGAAAACCTTA
GCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCGCTTCCTCCAGCCTGC
ACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGTGCGGGCCCCGGTGGG
AGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAGATAGCTCCAGCGATG
GCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGTGGATGTTGTGCAAAC
TCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGGGCCCAGGGTGGGTGA
GGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCCACCGCTGAGCGGATC
ACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGAATCCTGCCATCATCT
TTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGCCAACCAGGTCAGAAG
TTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCAAATTTGGTGCGGTGAGGGAGTGGATAAGTTGAGCCTC
CCTGCCAGGAACCAGGCAGGCTACTTTATGCTTCCCACGGTGATAACAGACATTAAGGATGAATCCTGCT
GCATGACGGAAGAGATATTTGGTCCAGTGACGTGTGTCGTCCCCTTTGATAGTGAAGAGGAGGTGATTGA
AAGAGCCAACAACGTTAAGTATGGGCTGGCGGCTACCGTGTGGTCCAGCAATGTGGGGCGCGTCCACCGG
GTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGGACCAACTGCTGGCTCATCAGGGAGCTGAACCTTCCTT
TCGGGGGGATGAAGAGTTCTGGAATAGGTAGAGAGGGAGCCAAGGACTCTTACGACTTCTTCACTGAGAT
CAAAACCATCACCGTTAAACACTGATCTTTGCTAATGGTGGAGCCACTATGGCCAATGCCTGGCTGCAGG
CATCAGTTGTTCAATGTGGTAGATGAAAATCATGGCATGAATTCCAGCTATGCCTTGACTTGGCAGAAGG
TTATCTCTAGCTTATCCTCAGTTCTTAGTAACTTTACCCACTAGTGAAGAGATACTGTCTATTTTCAATG
TGGACTCGGAAAAAAAGACTTATAAGTAGGAAGATAGAACAATGATGCCAGTTGTCAGGCTCCTCCCAGG
TTATGTTTTCATAGTGTTTCTTTCATCATCTTCATTGAACTCTTGGGAATCTCCAGATAATCAGATTATT
TCATTTGGTAAATTTTAAAAAATATGCAATCAGGCACAGTGCCTCATGCCTATAATCCCAGCACTTTGGG
AGGCCAAGGTGGGTGGATCACTTGAGTTCAGGAGTTCGAGATCAGCCTAGGCAACATGGTGAAATCCTGT
CTTTACCAAAAGTTTAAAAATTAGCTTGGTGTGGTGCCCTCTGCCTATAGCCCCAGCTACTTGGGAGGCT
GAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTGAGGCTGCAGTGAGCCATGATCATTCCACTGCATTTCA
GCCTGGGGGATACAGTGAGACCTTGTCTTTAAAAAAAAAATGCTGCAAAACCAAAAATAAATAGCCATAA
TTTGCCATCTTTGGAGAGATTATGGAGATAATCTCCTTGTCTATTAGCCACTAGCATGGCTAATTGATCA
TTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTTGTTAGGGGAAGGCTATGTGGTA
AGCTCTACTAAATGTATCTGTACAAGGATGAAGAAAAACAAAATAACTACTACTTTTGGAGGAAACTTGG
AACAAGAAGAGTACATAGTTTGATCCATTCCTACGGTCGAGTCTAATCAATTCCATTTCTTAGTGTATGC
ATCTAATGAGGCTTACAACTTGCTAACCCCAAAAGAAGCAATAAATGTTAAGCAATTTTAGTAACCAGT

>ALDH8A1_v2_ENST00000367845(Source : EBI, WTSI - Ensembl - TransView, Homo sapiens)
GGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTATGGCTGGAACAAACGC
ACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATATATAGATTCTTACGAC
CCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCGAAGCCGCGGTCAAGG
CCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACGGGTCCTGAACCAGGT
GGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGACCAAGGGAAAACCTTA
GCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCGCTTCCTCCAGCCTGC
ACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGTGCGGGCCCCGGTGGG
AGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAGATAGCTCCAGCGATG
GCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGTGGATGTTGTGCAAAC
TCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGGGCCCAGGGTGGGTGA
GGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCCACCGCTGAGCGGATC
ACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGAATCCTGCCATCATCT
TTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGCCAACCAGGTCAGAAG
TTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCAAATTTGGTGCGGTGAGGGAGTGGATAAGTTGAGCCTC
CCTGCCAGGAACCAGGCAGGCTACTTTATGCTTCCCACGGTGATAACAGACATTAAGGATGAATCCTGCT
GCATGACGGAAGAGATATTTGGTCCAGTGACGTGTGTCGTCCCCTTTGATAGTGAAGAGGAGGTGATTGA
AAGAGCCAACAACGTTAAGTATGGGCTGGCGGCTACCGTGTGGTCCAGCAATGTGGGGCGCGTCCACCGG
GTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGGACCAACTGCTGGCTCATCAGGGAGCTGAACCTTCCTT
TCGGGGGGATGAAGAGTTCTGGAATAGGTAGAGAGGGAGCCAAGGACTCTTACGACTTCTTCACTGAGAT
CAAAACCATCACCGTTAAACACTGATCTTTGCTAATGGTGGAGCCACTATGGCCAATGCCTGGCTGCAGG
CATCAGTTGTTCAATGTGGTAGATGAAAATCATGGCATGAATTCCAGCTATGCCTTGACTTGGCAGAAGG
TTATCTCTAGCTTATCCTCAGTTCTTAGTAACTTTACCCACTAGTGAAGAGATACTGTCTATTTTCAATG
TGGACTCGGAAAAAAAGACTTATAAGTAGGAAGATAGAACAATGATGCCAGTTGTCAGGCTCCTCCCAGG
TTATGTTTTCATAGTGTTTCTTTCATCATCTTCATTGAACTCTTGGGAATCTCCAGATAATCAGATTATT
TCATTTGGTAAATTTTAAAAAATATGCAATCAGGCACAGTGCCTCATGCCTATAATCCCAGCACTTTGGG
AGGCCAAGGTGGGTGGATCACTTGAGTTCAGGAGTTCGAGATCAGCCTAGGCAACATGGTGAAATCCTGT
CTTTACCAAAAGTTTAAAAATTAGCTTGGTGTGGTGCCCTCTGCCTATAGCCCCAGCTACTTGGGAGGCT
GAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTGAGGCTGCAGTGAGCCATGATCATTCCACTGCATTTCA
GCCTGGGGGATACAGTGAGACCTTGTCTTTAAAAAAAAAATGCTGCAAAACCAAAAATAAATAGCCATAA
TTTGCCATCTTTGGAGAGATTATGGAGATAATCTCCTTGTCTATTAGCCACTAGCATGGCTAATTGATCA
TTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTTGTTAGGGGAAGGCTATGTGGTA
AGCTCTACTAAATGTATCTGTACAAGGATGAAGAAAAACAAAATAACTACTACTTTTGGAGGAAACTTGG
AACAAGAAGAGTACATAGTTTGATCCATTCCTACGGTCGAGTCTAATCAATTCCATTTCTTAGTGTATGC
ATCTAATGAGGCTTACAACTTGCTAACCCCAAAAGAAGCAATAAATGTTAAGCAATTTTAGTAA

>ALDH8A1_v2_NM_170771(Source : NCBI - GenBank, Homo sapiens)
GGGACAACCTGAGTGCTCAGTCGTAAAGAGGAAAGGCAGAATTTTTCCTTGCTATGGCTGGAACAAACGC
ACTTTTGATGCTGGAAAACTTCATAGATGGAAAATTTTTACCTTGTAGCTCATATATAGATTCTTACGAC
CCATCAACAGGGGAAGTGTATTGCAGAGTGCCAAATAGTGGAAAAGACGAGATCGAAGCCGCGGTCAAGG
CCGCCAGAGAAGCCTTTCCCAGCTGGTCATCCCGCAGCCCCCAGGAGCGCTCACGGGTCCTGAACCAGGT
GGCGGATTTGCTGGAGCAGTCCCTGGAGGAGTTTGCCCAGGCCGAGTCTAAAGACCAAGGGAAAACCTTA
GCACTGGCAAGAACCATGGACATTCCCCGGTCTGTGCAGAACTTCAGGTTCTTCGCTTCCTCCAGCCTGC
ACCACACGTCAGAGTGCACGCAGATGGACCACCTGGGCTGCATGCACTACACGGTGCGGGCCCCGGTGGG
AGTCGCTGGTCTGATCAGCCCCTGGAATTTGCCACTCTACTTGCTGACCTGGAAGATAGCTCCAGCGATG
GCTGCAGGGAACACTGTGATAGCCAAGCCCAGTGAGCTGACTTCAGTGACTGCGTGGATGTTGTGCAAAC
TCCTGGATAAAGCAGGTGTTCCACCAGGTGTGGTCAATATTGTGTTTGGAACCGGGCCCAGGGTGGGTGA
GGCCCTGGTGTCCCACCCAGAGGTGCCCCTGATCTCCTTCACCGGGAGCCAGCCCACCGCTGAGCGGATC
ACCCAGCTGAGCGCTCCCCACTGCAAAAAGCTCTCCCTGGAGCTGGGGGGCAAGAATCCTGCCATCATCT
TTGAGGACGCCAACCTGGATGAGTGCATTCCGGCAACCGTCAGGTCCAGCTTTGCCAACCAGGTCAGAAG
TTACGTCAAGAGAGCTCTTGCTGAAGGTGCCCAAATTTGGTGCGGTGAGGGAGTGGATAAGTTGAGCCTC
CCTGCCAGGAACCAGGCAGGCTACTTTATGCTTCCCACGGTGATAACAGACATTAAGGATGAATCCTGCT
GCATGACGGAAGAGATATTTGGTCCAGTGACGTGTGTCGTCCCCTTTGATAGTGAAGAGGAGGTGATTGA
AAGAGCCAACAACGTTAAGTATGGGCTGGCGGCTACCGTGTGGTCCAGCAATGTGGGGCGCGTCCACCGG
GTGGCTAAGAAGCTGCAGTCTGGCTTGGTCTGGACCAACTGCTGGCTCATCAGGGAGCTGAACCTTCCTT
TCGGGGGGATGAAGAGTTCTGGAATAGGTAGAGAGGGAGCCAAGGACTCTTACGACTTCTTCACTGAGAT
CAAAACCATCACCGTTAAACACTGATCTTTGCTAATGGTGGAGCCACTATGGCCAATGCCTGGCTGCAGG
CATCAGTTGTTCAATGTGGTAGATGAAAATCATGGCATGAATTCCAGCTATGCCTTGACTTGGCAGAAGG
TTATCTCTAGCTTATCCTCAGTTCTTAGTAACTTTACCCACTAGTGAAGAGATACTGTCTATTTTCAATG
TGGACTCGGAAAAAAAGACTTATAAGTAGGAAGATAGAACAATGATGCCAGTTGTCAGGCTCCTCCCAGG
TTATGTTTTCATAGTGTTTCTTTCATCATCTTCATTGAACTCTTGGGAATCTCCAGATAATCAGATTATT
TCATTTGGTAAATTTTAAAAAATATGCAATCAGGCACAGTGCCTCATGCCTATAATCCCAGCACTTTGGG
AGGCCAAGGTGGGTGGATCACTTGAGTTCAGGAGTTCGAGATCAGCCTAGGCAACATGGTGAAATCCTGT
CTTTACCAAAAGTTTAAAAATTAGCTTGGTGTGGTGCCCTCTGCCTATAGCCCCAGCTACTTGGGAGGCT
GAGGTGGGAGGATCGCTTGAGCCCAGGCGGTTGAGGCTGCAGTGAGCCATGATCATTCCACTGCATTTCA
GCCTGGGGGATACAGTGAGACCTTGTCTTTAAAAAAAAAATGCTGCAAAACCAAAAATAAATAGCCATAA
TTTGCCATCTTTGGAGAGATTATGGAGATAATCTCCTTGTCTATTAGCCACTAGCATGGCTAATTGATCA
TTGATTGGACCTCATTACATAAGGGGGCTGTGGACGTCTTTGGAATTTGTTAGGGGAAGGCTATGTGGTA
AGCTCTACTAAATGTATCTGTACAAGGATGAAGAAAAACAAAATAACTACTACTTTTGGAGGAAACTTGG
AACAAGAAGAGTACATAGTTTGATCCATTCCTACGGTCGAGTCTAATCAATTCCATTTCTTAGTGTATGC
ATCTAATGAGGCTTACAACTTGCTAACCCCAAAAGAAGCAATAAATGTTAAGCAATTTTAGTAACCAGTA
AAAAAAA